This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGCTTACCTAGCCGTCTTC targeting the 5' side and CACACAAGTACAATCTAGGG targeting the 3' side of a critical region (ENSMUSE00001445593 & ENSMUSE00001048285) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 1,229-bp deletion of Chr16 from 18,362,769 to 18,363,997 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCTT).