A TI{KozakGAL4} DNA cassette has been inserted into CG43346, replacing the coding sequence (coordinates of deleted sequence are 2L:21166108..21166555, release 6 genome). This results in a simultaneous knock-out of CG43346 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG43346 (predicted to gene trap all annotated transcripts of the gene). The deletion removes part of a dicistronic transcript that encodes CG43345 as well as CG43346 and thus expression of CG43345 may also be affected. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTCTTAAGTTAAAATAAGCATGG and ATATAGAGTTACTTCTCCGGTGG. The 3' end of the deletion associated with the insertion is 18 bp downstream of the 3' end of the Noc2 gene and may affect the proper 3' end formation of its transcripts.