A TI{KozakGAL4} DNA cassette has been inserted into Mkp, replacing the coding sequence (coordinates of deleted sequence are 3L:182541..184412, release 6 genome). The deletion affects a dicistronic transcript that encodes CG34140 and one of the isoforms of Mkp and the protein coding sequence of CG34140 is also deleted. This results in a simultaneous knock-out of Mkp and CG34140 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Mkp and CG34140. The 3' end of the deletion associated with the insertion is 6 bp downstream of the 3' end of the CG13875 gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATATCGCTAGAGATGGGCTTGGG and TTTAAAACTTGAGAGTTTAGTGG.