Version: 8.0.0Date: Tue Jan 28 2025
Allele/Variant
Scer\GAL4FIG4-CR70613-KO-kG4
- Species
- Drosophila melanogaster
- Symbol
- Scer\GAL4FIG4-CR70613-KO-kG4
- Category
- allele
- Allele of gene
- None
- Transgenic Constructs
- Synonyms
- Scer\GAL4[FIG4-CR70613-KO-kG4]
- Description
- A TI{KozakGAL4} DNA cassette has been inserted into FIG4, replacing the coding sequence (coordinates of deleted sequence are 2L:4465189..4468027, release 6 genome). This results in a simultaneous knock-out of FIG4 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of FIG4 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of ine. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GTTTGTTGTTTATGTGGGAGCGG and TAAATTCTAGAGCGAGACATTGG.
- Additional Information
- Literature
Transgenic Constructs
This allele contains 1 transgenic construct- Symbol
- TI{KozakGAL4}
- Expressed Components
- GAL4
- Knock-down Targets
- None
- Regulatory Regions
- None