A TI{KozakGAL4} DNA cassette has been inserted into Sas-4, replacing the coding sequence (coordinates of deleted sequence are 3R:7151367..7154165, release 6 genome). This results in a simultaneous knock-out of Sas-4 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Sas-4 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 73 bp from the 3' end of MAGE and may affect the proper 3' end formation of its transcripts. The 5' end of the deletion associated with the insertion is 97 bp from the 3' end of CG2656 and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with a 3' homology arm of length 200bp and the 5' homology arm extended to restore the promoter. The sgRNA sequences used to target the gene were: TGTTTAGACGCCGTACGCGTAGG and ACTATGCCAAGTATTAGAGTCGG.