This allele from project Myh10-6078J-P4M2R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTCCACAAAGAGATACCTCT, which resulted in a 4 bp deletion GGTA in exon 2 beginning at Chromosome 11 positive strand position 68699275bp (GRCm38) and is predicted to cause amino acid sequence changes after residue 11 and an early truncation 66 amino acids later.