This allele from project Abhd17b-7064J-M4843 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTCATTAAACCTATTTGGGA, TTTCAAGAACCCTCCCAAAT, ATGCTGCATAAGTTATACTG, and GTATAACTTATGCAGCATAA, which resulted in a 632 bp deletion in intron 2 beginning at Chromosome 19 positive strand position 21,678,217 bp, ATTTGGGAGGGTTCTTGAAATTATA, and ending after TGGTTTTTACCCTTATGCTGCA at 21,678,848 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and the splice acceptor and is predicted to generate a null allele.