This allele from project Tbc1d5-7380J-M1353 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTCAGTGATCCCTGTGT, TAGGAAAGGAACCAGATCAG, AGCACTCCTCTTGTAGTAGA, and CCTGGAAGATTACCCACACA, which resulted in a 231 bp deletion spanning exon 5 beginning at Chromosome 17 negative strand position 50,968,324 bp, CCCCTGATCTGGTTCCTTTCC, and ending after CCACACAGGGATCACTGAAA at 50,968,094 bp (GRCm38/mm10). This mutation deletes exon 5 and 112 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after 55 residues and early truncation 14 amino acids later.