This allele from project Pcnxl2-7417J-M4954 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAATGTTTCTGTCTGCGGTG, TTGTAACTAAGAGCTCTTTT, CTTAGAGGTTTAAAGCGAAG, and TCTTTACTGAGCACAAGTCA, which resulted in a 476 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 125,891,793 bp, TTTTGGGAGCTGGCACTCTCCT and ending after ATCAGTCACTTTGATGACCAA at 125,892,268 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after residue 51 and early truncation 1 amino acid later.