This allele from project Med10-7684J-M3179 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCTGGACCAGGTCCTGTGA, CTCAAGCGTGTAAGCACACC, TGATGTCTGCACACGGACAA and GCTGAGTACTGCTACACTGT, which resulted in a 330 bp deletion spanning exon 3 beginning at Chromosome 13 positive strand position 69,813,580 bp, ACCCGGCTCCTGGACCAGGT, and ending after GGACTGCTGAGTACTGCTAC at 69,813,909 bp (GRCm38/mm10). This mutation deletes exon 3 and 227 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 5 amino acids later.