This allele from project Lmcd1-7683J-M3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATGCCAAGTCTCCCAG, GCTGCCACTCACTGTTTACT, GACGGTGTAGGATGCATGCT and GAGAGAACCACCCACAGTTT, which resulted in a 276 bp deletion spanning exon 2 beginning at Chromosome 6 positive strand position 112,304,920 bp, CAGTAAACAGTGAGTGGCAG, and ending after CTTGACTGTCCTTTCCAAAA at 112,305,195 bp (GRCm38/mm10). This mutation deletes exon 2 and 187 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a small 12 bp deletion 33 bp after the 276 bp deletion which will not affect the mutation. The 276 bp deletion is predicted to cause a change of amino acid sequence after residue 14 and early truncation 6 amino acids later.