This allele from project Pcyox1l-7923J-M8904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACGGTAAATCCAAGGGC, GCCCAGCCGGATGAGTGTGT, TCCTCTTCAAGGACCCCAGG and GCCTTCCTGATGCAAATGGC, which resulted in a 469 bp deletion beginning at Chromosome 18 negative strand position 61,702,507 bp AAAATAGACAGTTCCAGCCA, and ending after CAGAGCCCCACGTGTCATAC at 61,702,039 bp (GRCm38/mm10). This mutation deletes exon 3 and 294 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 13 amino acids later.