This allele from project Wdr81-7808J-F751 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGGTTTGACGAACCA, CCTGGAACCCCCAAGACCTG, TGGGTTTTCTTGGGTAAGTG and CAGCGTTGAGAAGCCAGTGG, which resulted in a 290 bp deletion beginning at Chromosome 11 negative strand position 75,449,570 bp CTGGCTTCTCAACGCTGCTG, and ending after GATCCAAGGACCAGCCCCAG at 75,449,281 bp (GRCm38/mm10). This mutation deletes exon 3 and 99 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1252 and early truncation 34 amino acids later.