This allele from project Nars2-7918J-F3847 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGCTGACATAAGAGAA, ATTCAGAAAAAGACTGCTAG, GTGAAAATGTTAGACCTTAA and GAACTCTTTAGAAAAGAAAG, which resulted in a 365 bp deletion beginning at Chromosome 7 positive strand position 96,955,866 bp CTAGCAGTCTTTTTCTGAAT, and ending after GAACCAGGAGCCCTTAAGGT at 96,956,230 bp (GRCm38/mm10). This mutation deletes exon 2 and 255 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 31 amino acids later. There is a single bp (G) insertion 53 bp before the 365 bp deletion that will not alter the results of the deletion.