This allele from project Tubgcp4-7966J-M7404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTATATAGACATCTTGGG, TTCTGTAACCTAGATTGATA, TCCGTAAGTATTGGGAATAG and TCCCAATACTTACGGAAGCC, which resulted in a 204 bp deletion beginning at Chromosome 2 positive strand position 121,178,575 bp GGGAGGGACTATATTAGCTA, and ending after GGCTTCCGTAAGTATTGGGA at 121,178,778 bp (GRCm38/mm10). This mutation deletes exon 6 and 124 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 10 amino acids later.