This allele from project Arv1-8104J-M9010 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTAAAGAAGCCGTGAGCCG, GCTGCGGTAGGTATGCCTCT, TTAGTGGCTGAGCTGAGATA and GCATTACTAGTTGTCTCACC, which resulted in a 290 bp deletion beginning at Chromosome 8 positive strand position 124,728,265bp TCTTGGCATGCCCTCGGCTC and ending after AATCAAAGCTAAGACCTGGT at 124,728,554 bp (GRCm38/mm10). This mutation deletes exon 3 and 154 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 2 bp deletion in intron 4 after the 290 bp deletion that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 93 and early truncation 18 amino acids later.