This allele from project Zfp7-8177J-F8938 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGCTGTGTCTGTTCAGTG, AGGTATGCGATCAGGCCCAG, CCGGTCTGACCGGTTCCCAG and CCAGGTCTGCTCCAAACCCC, which resulted in a 436 bp deletion beginning at Chromosome 15 positive strand position 76,880,855 bp GGCCTGATCGCATACCTAGC, and ending after CTCCAAACCCCGGGCACGTG at 76,881,288 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 9 amino acids later.