This allele from project Brip1-8371J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCAGTAAAAACACACACG, TGATATTTCAGACTGCTAGT, CAGGAAACACAGTTACAGCG and CTTCTGTGCTGTTCTAGTCG, which resulted in a 407 bp deletion beginning at Chromosome 11 negative strand position 86,198,119 bp, CGCGCTGTAACTGTGTTTCC, and ending after CGTGTGTGTTTTTACTGAGC at 86,197,713 bp (GRCm38/mm10). This mutation deletes exon 3 and 295 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 7 amino acids later.