This allele from project Kctd1-8309J-F0739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACCTACAGAAGCTGCTCA, CTCCATGTCCCCGCTTGTGG, CACAGTATACAAATAACAAG and TTACTGCAATTGATCCCCAT, which resulted in a 571 bp deletion beginning at Chromosome 18 negative strand position 15,008,135 bp, TTGTTATTTGTATACTGTGA, and ending after GCCATGGATGCCTGGCCTCC at 15,007,565 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 6 bp insertion (CCTCCA) at the deletion site that will not alter the results of the mutation. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 5 amino acids later.