This allele from project Mmaa-8355J-F0649 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCATGGCCTCTAGCCAAT, ATGTACAGAGAAACAGCCTG, GGGTGCTGAGTTATAGCAAC and TTTACTTTTTTCCAATTTAC, which resulted in a 345 bp deletion beginning at Chromosome 8 negative strand position 79,271,097 bp, AACAGGTCATAAATCTATGA, and ending after TAGAGGCCATGAGGCCACAG at 79,270,753 bp (GRCm38/mm10). This mutation deletes exon 5 and 259 bp of flanking intronic sequence including the splice acceptor and donor. At the site of this deletion there is a 22 bp insertion (TGTGGCCTCATGGCCTCTAGCC) that derived from nearby intronic sequence, which is inverted relative to its normal orientation. This allele is predicted to cause a change of amino acid sequence after residue 242 and early truncation 6 amino acids later.