This allele from project Nt5dc3-8542J-8383M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGGGTGGCTTCTAAACAGA, TGTCATCTCCTGGGATAGAT, GGTCTGGGCATGAATGCGCA and TCTACTCTTCAGACACCAAA, which resulted in a 343 bp deletion beginning at Chromosome 10 positive strand position 86,804,714 bp, CTCTGTTTAGAAGCCACCCA, and ending after ATTCATGCCCAGACCCTGCC at 86,805,056 bp (GRCm38/mm10). This mutation deletes exon 2 and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later.