This allele from project Idh3b-8297J-2446F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCAGACACAACTAACA, AAATTCCTAAATGTCAGTAG, TTGCCTTCTTTTGGAAACCG and AGGTCAGATCGGGGACACCG, which resulted in a 772 bp deletion beginning at Chromosome 2 negative strand position 130,284,280 bp, GTGTCCCCGATCTGACCTTG, and ending after GGGTCAGACCCTGTTAGTTG at 130,283,509 bp (GRCm38/mm10). This mutation deletes exons 2,3,4 and 474 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later.