This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGAGCCTAGTACGAAGCAT, GCTGGGCACTAGACATTCCC, ATAGGTTATGAAATGATGCG and GCAAGCACATTTTTACATCT, which resulted in a 406 bp deletion beginning at Chromosome 9 negative strand position 75,676,874 bp, TGAAATGATGCGTGGACTAG, and ending after GCTTGCCAGGGAATGTCTAG at 75,676,469 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217477 (exon 5) and 263 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 1 amino acid later.