This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCCCTCCTCCCCACACTATA, AATGCTAACTGTTCTCTCTC and TGGCCCAAGCAGAGAGGAGA, which resulted in a 222 bp deletion beginning at Chromosome 14 positive strand position 31,210,481 bp and ending after 31,210,702 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001063990(exon 4) and 107 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp intronic deletion (GAGAAG) 18 bp after the 222 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later.