This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGGTGACTGCCTGACAG, GTCTGTAGCTGACCCTTGCG, GATGAGTGTAGGAATCTGGT and TAGTGCACATGCGGTTAGAA, which resulted in a 784 bp deletion beginning at Chromosome 3 negative strand position 88,931,104 bp and ending after 88,930,321 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000567034 and ENSMUSE00000567033 (exons 5-6) and 582 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 5 bp (CATAT) retention of endogenous sequence that will not alter the results of the exon deletions. This mutation is predicted to cause a change of amino acid sequence after residue 88 and early truncation 4 amino acids later.