This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAACTAAAACCTTAACTAAT, GGTTACATTATGCCCTAAAC, ACATTACCTTCAAAACTTGG and TTCTTGCCCCCAAGTTTTGA, which resulted in a 278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp and ending after 128,016,216 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205993 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp insertion (ATCTGA) at the deletion site and a 4 bp deletion (CTAA) 33 bp after the 278 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 21 amino acids later.