This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTACCCCCTGGACGCCAGGC, TCTTCCCGCCTGGCGTCCAG, GTCGTTCGTCCTGTCCAGAA and CTGTCCAGAATGGCAGCCTG, which resulted in a 736 bp deletion beginning at Chromosome 10 positive strand position 127,192,621 bp and ending after 127,193,356 bp (GRCm38/mm10). This mutation creates an internal deletion in ENSMUSE00000519601 (exon 4) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 32 amino acids later.