This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGGCTTTCGGTATCTGCT, AGACAACAGATGACACCTTT, CGTGCTGCGACTTTTCCCTG and TCCTAAATAGATACTGGTGT, which resulted in a 292 bp deletion beginning at Chromosome 4 negative strand position 57,648,243 bp and ending after 57,647,952 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001288752 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later.