This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGTGGTGTGATGTGAAAGG, GGTGAACGTTAGTTACATGG, GTGTTAGGACATAATTGCAA and TCCCCACGCCCTGAGAAGGG, which resulted in a 578 bp deletion beginning at Chromosome 3 positive strand position 153,850,524 bp and ending after 153,851,101 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000257803 (exon 2) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 2 amino acids later.