This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATTGCAAATGATAAGCAA, GAGTTTCTTTGGGATAACAA, GAGTTTCTTTGGGATAACAA and CCAGTATGTTAAAGCTTATG, which resulted in a 559 bp deletion beginning at Chromosome 4 positive strand position 21,892,681 bp and ending after 21,893,239 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340164 (exon 2) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 42 amino acids later.