This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGCATCCAACCAAGAAAA, TGCGTTCACAAGTTTCATAA, GTAGTTTCTAAAATCAAAGC and TCAGGCTATAAAAAGTTACC, which resulted in a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370997, ENSMUSE00000385562, ENSMUSE00000348886 (exons 3,4,5) and 454 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 205 and early truncation 2 amino acids later.