This allele from project TCPR0445 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CGCAAAAGGAACGCACAAGC and AGGGCTTGAGGATTCCGGTT targeting the 5' side and CCTGCCCTGTCTTAATGGGC and GTGCAAGAGGCCCTGCTAGG targeting the 3' side of a critical region. This resulted in a 221 bp deletion of Chr11 from 120657737 to 120658957.(GRCm38).