This allele from project TCPR0619 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGGCGGGACTGTGGCACCC and CGATCTCCAACTAGGATGTG targeting the 5' side and GCCCAAACCATAGAGGTAGA and CTGGGCAAGTGAGTAACTAT targeting the 3' side of exon ENSMUSE00000396327 resulting in a 609-bp deletion of Chr12 from 112112806 to 112113414 (GRCm38).