This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTATAGTATCTGAGTGTA and TAGGGTCCGTTAGCATTAAA, which resulted in a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244447 and ENSMUSE00001218869 (exons 3 and 4) and 524 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 13 amino acids later.