This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGTTATTGGACAAGTGTAA, TTTTACATGGACTAATTACA, AGCAAAAATGGGGTGAGCAT and GGTAATAAGAAATTAACTAA, which resulted in a 522 bp deletion beginning at Chromosome 3 position 95,789,969 bp and ending after 95,790,490 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000176218 (exon 2) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 8 amino acids later.