This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTATGCCGAAAATTCTAGT and TACATGACGAGTAGCCAGCA, which resulted in a 352 bp deletion beginning at Chromosome 14 position 26,592,173 bp and ending after 26,592,524 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355312, and ENSMUSE00000398626 (exons 2 and 3) and 270 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 35 amino acids later.