This allele from project TCPR0997 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCCCAGAGTATACGGCACT and ATTGCCAAGGTGCCAGCTTG targeting the 5' side and ACAAGGATGTAGACCCTACC and ATCTAATAGCCTCCCTACTC targeting the 3' side of a critical region. This resulted in a 492-bp del ch11:72540262 to 72540753_insA (GRCm38).