This allele from project TCPR1119 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATATACGAAGGCTTGAAACC targeting the 5' side and CGGACTACGGGCTTACTCCG targeting the 3' side of a critical exon. This resulted in a 220-bp deletion from Chr6: 128571947 to 128572166 resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38)