This allele from project TCPR1120 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATTTGTGTGGCAATACCGT targeting the 5' side and CACGTTCCCACAAACTCATC targeting the 3' side of a critical exon. This resulted in a 125-bp del Chr1:98428310 to 98428434 c.598_722del; p.V200Ifs*27.(GRCm38).