This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTGACAATGTTATCAAGAT and GCGTGTGTCCTATAGAAGGC, which resulted in a 301 bp deletion beginning at Chromosome 9 position 51,825,735 bp and ending after 51,826,035 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216120 (exon 6) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 4 amino acids later.