This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACGCCGTTTCGAGCGA and GTAATTGATGAAGTGTTAGT, which resulted in a 1108 bp deletion beginning at Chromosome 9 position 63,524,247 bp and ending after 63,525,354 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324999 (exon 10) and 456 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 288, remove 188 amino acids, and return into frame for the stop codon.