This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGCACATATGAGACGCA and CTGCAGGCCGGTCCTAAGCA, which resulted in a 406 bp deletion beginning at Chromosome 7 position 46,178,322 bp and ending after 46,178,727 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001040856 (exon 2) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 50.