This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGAAGTTCATAGCCACA and CCACCACTGCAACCCTTTCT, which resulted in a 531 bp deletion beginning at Chromosome 8 position 84,159,196 bp and ending after 84,159,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000267236 (exon 3) and 368 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 43 amino acids later.