This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCCATGAAAGATCATCA and TTCCCAATGCTCCAGAGACG, which resulted in a 412 bp deletion beginning at Chromosome 18 position 43,966,767 bp and ending after 43,967,178 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000438072 (exon 3) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 27 and early truncation 21 amino acids later.