This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATAAGAACTGTGTCTAGTA and CAATGGTCAGAACTTCGCCA, which resulted in a 259 bp deletion beginning at Chromosome 5 position 73,411,781 bp and ending after 73,412,039 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000186304 (exon 3) and 138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 23 amino acids later.