This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATACCAGTATGGAGCCA and ACTTATGCATTGGCATGTCC, which resulted in a 446 bp deletion beginning at Chromosome 1 position 44,708,334 bp and ending after 44,708,779 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291010 (exon 3) and 384 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 32 amino acids later.