This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTACACTGCAAAGAGAGCA and ACTTACTACCTCTCTAGAAC, which resulted in a 548 bp deletion beginning at Chromosome 13 position 119,702,388 bp and ending after 119,702,935 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001063943 (exon 5) and 382 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 246 and early truncation 4 amino acids later.