This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAACAGAGGGTCACTGCA and GAGACATCTCACTTCCTTGA, which resulted in a 965 bp deletion beginning at Chromosome 18 position 84,730,001 bp and ending after 84,730,965 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000374665 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele.