This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTTTGTACTCAAACTGAA and TTTTCAAACCTAGTAACCAA, which resulted in a 750 bp deletion beginning at Chromosome 3 position 159,515,449 bp and ending after 159,516,198 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000399599 and ENSMUSE00000361974 (exons 4 and 5) and 497 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 157 and early truncation 10 amino acids later.