This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTCCTAGCACCAAGGAG and CCTGGGAGCAGGCAACCATA, which resulted in a 552 bp deletion beginning at Chromosome 5 position 35,841,047 bp and ending after 35,841,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185461 (exon 11) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 350 and early truncation 37 amino acids later.